-
-
Notifications
You must be signed in to change notification settings - Fork 48
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
44 changed files
with
5,105 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,19 @@ | ||
# Generated by roxygen2: do not edit by hand | ||
|
||
S3method("$",module) | ||
S3method(print,module) | ||
export("?") | ||
export(help) | ||
export(import) | ||
export(import_) | ||
export(import_package) | ||
export(import_package_) | ||
export(module_file) | ||
export(module_help) | ||
export(module_name) | ||
export(register_S3_method) | ||
export(reload) | ||
export(set_script_path) | ||
export(unload) | ||
importFrom(stats,setNames) | ||
importFrom(utils,lsf.str) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,66 @@ | ||
## ----include=FALSE------------------------------------------------------- | ||
devtools::load_all() | ||
import('source-file') | ||
|
||
## ------------------------------------------------------------------------ | ||
seq = import('utils/seq') | ||
ls() | ||
|
||
## ------------------------------------------------------------------------ | ||
ls(seq) | ||
|
||
## ----eval=FALSE---------------------------------------------------------- | ||
# ?seq$seq | ||
|
||
## ------------------------------------------------------------------------ | ||
s = seq$seq(c(foo = 'GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC', | ||
bar = 'CATAGCAACTGACATCACAGCG')) | ||
s | ||
|
||
## ------------------------------------------------------------------------ | ||
seq$print.seq | ||
|
||
## ------------------------------------------------------------------------ | ||
# We can unload loaded modules that we assigned to an identifier: | ||
unload(seq) | ||
|
||
options(import.path = 'utils') | ||
import('seq', attach = TRUE) | ||
|
||
## ------------------------------------------------------------------------ | ||
search() | ||
|
||
## ------------------------------------------------------------------------ | ||
detach('module:seq') # Name is optional | ||
local({ | ||
import('seq', attach = TRUE) | ||
table('GATTACA') | ||
}) | ||
|
||
## ------------------------------------------------------------------------ | ||
search() | ||
table('GATTACA') | ||
|
||
## ----file='utils/__init__.r'--------------------------------------------- | ||
|
||
## ------------------------------------------------------------------------ | ||
options(import.path = NULL) # Reset search path | ||
utils = import('utils') | ||
ls(utils) | ||
ls(utils$seq) | ||
utils$seq$revcomp('CAT') | ||
|
||
## ----eval=FALSE---------------------------------------------------------- | ||
# export_submodule('./seq') | ||
|
||
## ----file='info.r'------------------------------------------------------- | ||
|
||
## ------------------------------------------------------------------------ | ||
info = import('info') | ||
|
||
## ------------------------------------------------------------------------ | ||
import('info') | ||
|
||
## ------------------------------------------------------------------------ | ||
reload(info) | ||
|
Large diffs are not rendered by default.
Oops, something went wrong.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,289 @@ | ||
Basic module usage | ||
================== | ||
|
||
The `seq` module | ||
---------------- | ||
|
||
For the purpose of this tutorial, we are going to use the toy module | ||
`utils/seq`, which is implemented in the file | ||
[`utils/seq.r`](utils/seq.r). The module implements some very basic | ||
mechanisms to deal with DNA sequences (character strings consisting | ||
entirely of the letters `A`, `C`, `G` and `T`). | ||
|
||
First, we load the module. | ||
|
||
``` r | ||
seq = import('utils/seq') | ||
ls() | ||
``` | ||
|
||
## [1] "seq" | ||
|
||
`utils` serves as a supermodule here, which groups several submodules | ||
(but for now, `seq` is the only one). | ||
|
||
To see which functions a module exports, use `ls`: | ||
|
||
``` r | ||
ls(seq) | ||
``` | ||
|
||
## [1] "print.seq" "revcomp" "seq" | ||
## [4] "table" "valid_seq" "valid_seq.default" | ||
## [7] "valid_seq.seq" | ||
|
||
And we can display interactive help for individual functions: | ||
|
||
``` r | ||
?seq$seq | ||
``` | ||
|
||
This function creates a biological sequence. We can use it: | ||
|
||
``` r | ||
s = seq$seq(c(foo = 'GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC', | ||
bar = 'CATAGCAACTGACATCACAGCG')) | ||
s | ||
``` | ||
|
||
## >foo | ||
## GATTACAGATCAGCTCAGCACCTAGCACTATCAGCAAC | ||
## >bar | ||
## CATAGCAACTGACATCACAGCG | ||
|
||
Notice how we get a pretty-printed, | ||
[FASTA](http://en.wikipedia.org/wiki/FASTA_format)-like output because | ||
the `print` method is redefined for the `seq` class in `utils/seq`: | ||
|
||
``` r | ||
seq$print.seq | ||
``` | ||
|
||
## function (seq, columns = 60) | ||
## { | ||
## lines = strsplit(seq, sprintf("(?<=.{%s})", columns), perl = TRUE) | ||
## print_single = function(seq, name) { | ||
## if (!is.null(name)) | ||
## cat(sprintf(">%s\n", name)) | ||
## cat(seq, sep = "\n") | ||
## } | ||
## names = if (is.null(names(seq))) | ||
## list(NULL) | ||
## else names(seq) | ||
## Map(print_single, lines, names) | ||
## invisible(seq) | ||
## } | ||
## <environment: 0x7fe2603a8580> | ||
|
||
Attaching modules | ||
----------------- | ||
|
||
That’s it for basic usage. In order to understand more about the module | ||
mechanism, let’s look at an alternative usage: | ||
|
||
``` r | ||
# We can unload loaded modules that we assigned to an identifier: | ||
unload(seq) | ||
|
||
options(import.path = 'utils') | ||
import('seq', attach = TRUE) | ||
``` | ||
|
||
After unloading the already loaded module, the `options` function call | ||
sets the module search path: this is where `import` searches for | ||
modules. If more than one path is given, `import` searches them all | ||
until a module of matching name is found. | ||
|
||
The `import` statement can now simply specify `seq` instead of | ||
`utils/seq` as the module name. We also specify `attach=TRUE`. This has | ||
an effect similar to package loading (or `attach`ing an environment): | ||
all the module’s names are now available for direct use without | ||
necessitating the `seq$` qualifier. | ||
|
||
However, unlike the `attach` function, module attachment happens *in | ||
local scope* only. Since the above code was executed in global scope, | ||
there’s no distinction between local and global scope: | ||
|
||
``` r | ||
search() | ||
``` | ||
|
||
## [1] ".GlobalEnv" "module:seq" "devtools_shims" | ||
## [4] "package:modules" "package:stats" "package:graphics" | ||
## [7] "package:grDevices" "package:utils" "package:datasets" | ||
## [10] "rprofile" "Autoloads" "package:base" | ||
|
||
Notice the second position, which reads “module:seq”. But now let’s undo | ||
that, and attach (and use) the module locally instead. | ||
|
||
``` r | ||
detach('module:seq') # Name is optional | ||
local({ | ||
import('seq', attach = TRUE) | ||
table('GATTACA') | ||
}) | ||
``` | ||
|
||
## [[1]] | ||
## | ||
## A C G T | ||
## 3 1 1 2 | ||
|
||
Note that this uses `seq`’s `table` function, rather than `base::table` | ||
(which would have a different output). Furthermore, note that *outside* | ||
the local scope, the module is not attached: | ||
|
||
``` r | ||
search() | ||
``` | ||
|
||
## [1] ".GlobalEnv" "devtools_shims" "package:modules" | ||
## [4] "package:stats" "package:graphics" "package:grDevices" | ||
## [7] "package:utils" "package:datasets" "rprofile" | ||
## [10] "Autoloads" "package:base" | ||
|
||
``` r | ||
table('GATTACA') | ||
``` | ||
|
||
## | ||
## GATTACA | ||
## 1 | ||
|
||
This is very powerful, as it isolates separate scopes more effectively | ||
than the `attach` function. What is more, modules which are imported and | ||
attached inside another module *remain* inside that module and are not | ||
visible outside the module by default. | ||
|
||
Nevertheless, the normal, recommended usage of a module is with | ||
`attach=FALSE` (the default), as this makes it clearer which names we | ||
are referring to. | ||
|
||
Nested modules | ||
-------------- | ||
|
||
Modules can also be nested in hierarchies. In fact, here is the | ||
implementation of `utils` (in [`utils/__init__.r`](utils/__init__.r): | ||
since `utils` is a directory rather than a file, the module | ||
implementation resides in the nested file `__init__.r`): | ||
|
||
``` r | ||
seq = import('./seq') | ||
``` | ||
|
||
The submodule is specified as `'./seq'` rather than `'seq'`: the | ||
explicitly provided relative path prevents lookup in the import search | ||
path (that we set via `options(import.path=…)` earlier); instead, only | ||
the current directory is considered. | ||
|
||
We can now use the `utils` module: | ||
|
||
``` r | ||
options(import.path = NULL) # Reset search path | ||
utils = import('utils') | ||
ls(utils) | ||
``` | ||
|
||
## [1] "seq" | ||
|
||
``` r | ||
ls(utils$seq) | ||
``` | ||
|
||
## [1] "print.seq" "revcomp" "seq" | ||
## [4] "table" "valid_seq" "valid_seq.default" | ||
## [7] "valid_seq.seq" | ||
|
||
``` r | ||
utils$seq$revcomp('CAT') | ||
``` | ||
|
||
## ATG | ||
|
||
We could also have implemented `utils` as follows: | ||
|
||
``` r | ||
export_submodule('./seq') | ||
``` | ||
|
||
This would have made all of `seq`’s definitions immediately available in | ||
`utils`. This is sometimes useful, but should be employed with care. | ||
|
||
Implementing modules | ||
-------------------- | ||
|
||
`utils/seq.r` is, by and large, a normal R source file. In fact, there | ||
are only two things worth mentioning: | ||
|
||
1. Documentation. Each function in the module file is documented using | ||
the | ||
[roxygen2](http://cran.r-project.org/web/packages/roxygen2/index.html) | ||
syntax. It works the same as for packages. The *modules* package | ||
parses the documentation and makes it available via `module_help` | ||
and `?`. | ||
|
||
2. The module exports [S3 functions](http://adv-r.had.co.nz/S3.html). | ||
The *modules* package takes care to register such functions | ||
automatically but this only works for *user generics* that are | ||
defined inside the same module. When overriding “known generics” | ||
(such as `print`), we need to register these manually via | ||
`register_S3_method` (this is necessary since these functions are | ||
inherently ambiguous and there is no automatic way of finding them). | ||
|
||
Module files can contain arbitrary code. It is executed when loaded for | ||
the first time: subsequent `import`s in the same session, regardless of | ||
whether they occur in a different scope, will refer to the loaded, | ||
cached module, and will *not* reload a module. | ||
|
||
We can illustrate this by loading a module which has side-effects, | ||
`'info'`. | ||
|
||
``` r | ||
message('Loading module "', module_name(), '"') | ||
message('Module path: "', basename(module_file()), '"') | ||
``` | ||
|
||
Let’s load it: | ||
|
||
``` r | ||
info = import('info') | ||
``` | ||
|
||
## Loading module "info" | ||
|
||
## Module path: "vignettes" | ||
|
||
We have imported the module, and get the diagnostic messages. Let’s | ||
re-import the module: | ||
|
||
``` r | ||
import('info') | ||
``` | ||
|
||
… no messages are displayed. However, we can explicitly *reload* a | ||
module. This clears the cache, and loads the module again: | ||
|
||
``` r | ||
reload(info) | ||
``` | ||
|
||
## Loading module "info" | ||
|
||
## Module path: "vignettes" | ||
|
||
And this displays the messages again. The `reload` function is a | ||
shortcut for `unload` followed by `import` (using the exact same | ||
arguments as used on the original `import` call). | ||
|
||
The `info` module also show-cases two important helper functions: | ||
|
||
1. `module_name` contains the name of the module with which it was | ||
loaded. This is especially handy because outside of a module | ||
`module_name` is `NULL`. We can harness this in a similar way to | ||
Python’s `__name__` mechanism. | ||
|
||
2. `module_file` works equivalently to `system.file`: it returns the | ||
full path to any file within a module. This is helpful when | ||
distributing data files with modules, which are loaded from within | ||
the module. When invoked without arguments, `module_file` returns | ||
the full path to the directory containing the module source file. |
Oops, something went wrong.