From 38959974d5784c2edf24e3106d2baf6ed9b9b296 Mon Sep 17 00:00:00 2001 From: BjornFJohansson Date: Sun, 4 Dec 2016 11:24:32 +0000 Subject: [PATCH] added lots of new _repr_xyz methods --- PRIMERS.TXT | 5 + pydna/__init__.py | 53 +- pydna/_pretty.py | 4 +- pydna/amplify.py | 15 +- pydna/assembly.py | 37 +- pydna/download.py | 81 +- pydna/dsdna.py | 153 +-- pydna/primer_design.py | 2 +- run_test.py | 7 + .../jupyter_test_repr-checkpoint.ipynb | 881 ++++++++++++++++++ tests/jupyter_test_repr.ipynb | 881 ++++++++++++++++++ tests/sequence.gb | 41 + tests/subfolder/sequence.gb | 41 + tests/test_assemble_pGUP1.py | 5 +- tests/test_download.py | 1 - 15 files changed, 2062 insertions(+), 145 deletions(-) create mode 100644 PRIMERS.TXT create mode 100755 tests/.ipynb_checkpoints/jupyter_test_repr-checkpoint.ipynb create mode 100755 tests/jupyter_test_repr.ipynb create mode 100644 tests/sequence.gb create mode 100644 tests/subfolder/sequence.gb diff --git a/PRIMERS.TXT b/PRIMERS.TXT new file mode 100644 index 00000000..32ddbc22 --- /dev/null +++ b/PRIMERS.TXT @@ -0,0 +1,5 @@ + +>fw64 t-sequence +atgactgctaacccttc +>rv64 t-sequence +catcgtaagtttcgaac \ No newline at end of file diff --git a/pydna/__init__.py b/pydna/__init__.py index 9a78ee6a..288d2121 100644 --- a/pydna/__init__.py +++ b/pydna/__init__.py @@ -1,20 +1,15 @@ #!/usr/bin/env python3 # -*- coding: utf-8 -*- -# Copyright 2013,2014, 2015 by Björn Johansson. All rights reserved. -# This code is part of the Python-dna distribution and governed by its -# license. Please see the LICENSE.txt file that should have been included -# as part of this package. ''' - pydna - ~~~~~ +# pydna - The pydna package. +The pydna package. - :copyright: Copyright 2013 - 2015 by Björn Johansson. All rights reserved. - :license: This code is part of the pydna distribution and governed by its - license. Please see the LICENSE.txt file that should have been included - as part of this package. +:copyright: Copyright 2013 - 2016 by Björn Johansson. All rights reserved. +:license: This code is part of the pydna distribution and governed by its + license. Please see the LICENSE.txt file that should have been included + as part of this package. ''' @@ -32,7 +27,7 @@ ''' -Pydna caches results from the assembly2 dsdna and amplify +Pydna caches results from the assembly dsdna and amplify modules. pydna sets an environmental variable "pydna_cache" which can have three different values: @@ -325,3 +320,37 @@ def _open_folder(pth): from ._version import get_versions __version__ = get_versions()['version'] del get_versions + +class PydnaWarning(Warning): + """Pydna warning. + + Pydna uses this warning (or subclasses of it), to make it easy to + silence all warning messages: + + >>> import warnings + >>> from pydna import PydnaWarning + >>> warnings.simplefilter('ignore', PydnaWarning) + + Consult the warnings module documentation for more details. + """ + pass + + +class PydnaDeprecationWarning(PydnaWarning): + """pydna deprecation warning. + + Pydna uses this warning instead of the built in DeprecationWarning + since those are ignored by default since Python 2.7. + + To silence all our deprecation warning messages, use: + + >>> import warnings + >>> from pydna import PydnaDeprecationWarning + >>> warnings.simplefilter('ignore', PydnaDeprecationWarning) + + Code marked as deprecated will be removed in a future version + of Pydna. This can be discussed in the Pydna google group: + https://groups.google.com/forum/#!forum/pydna + + """ + pass diff --git a/pydna/_pretty.py b/pydna/_pretty.py index c8596c4c..12a2498b 100644 --- a/pydna/_pretty.py +++ b/pydna/_pretty.py @@ -7,8 +7,8 @@ class pretty_str(str): ''' Thanks to Min RK, UC Berkeley for this''' def _repr_pretty_(self, p, cycle): p.text(self) - def _repr_html_(self): - return "123" +# def _repr_html_(self): +# return "123" class pretty_unicode(str): def _repr_pretty_(self, p, cycle): diff --git a/pydna/amplify.py b/pydna/amplify.py index c19e8d21..5fb2dc89 100644 --- a/pydna/amplify.py +++ b/pydna/amplify.py @@ -167,13 +167,13 @@ class Amplicon(Dseqrecord): def __init__( self, record, + *args, template=None, forward_primer=None, reverse_primer=None, saltc=None, fprimerc=1000.0, rprimerc=1000.0, - *args, **kwargs): super().__init__(record, *args, **kwargs) @@ -199,6 +199,12 @@ def __repr__(self): '''returns a short string representation of the object''' return "Amplicon({})".format(self.__len__()) + def _repr_pretty_(self, p, cycle): + p.text("Amplicon({})".format(self.__len__())) + + def _repr_html_(self): + return "Amplicon({})".format(self.__len__()) + def flankup(self, flankuplength=50): '''Returns a Dseqrecord object containing flankuplength bases upstream of the forward primer footprint, Truncated if the template is not long enough. @@ -829,7 +835,7 @@ def pcr(*args, **kwargs): elif isinstance(s, str): s = SeqRecord(Seq(s)) else: - raise TypeError("the record property needs to be a string, a Seq object or a SeqRecord object") + raise TypeError("the record property needs to be a string, Seq, SeqRecord or Dseqrecord object") new.append(s) anneal_primers = Anneal( new[:-1], @@ -838,10 +844,7 @@ def pcr(*args, **kwargs): if anneal_primers: if len(anneal_primers.products) == 1: - result = anneal_primers.products.pop() - msg = "```\n"+result.__repr__()+"```" - display(Markdown(msg)) - return result + return anneal_primers.products[0] elif len(anneal_primers.products) == 0: raise Exception("No PCR products! {}".format(anneal_primers.report())) else: diff --git a/pydna/assembly.py b/pydna/assembly.py index accf5509..fb007ac7 100644 --- a/pydna/assembly.py +++ b/pydna/assembly.py @@ -44,21 +44,23 @@ def display(item): return item Markdown = display -class Fragment(Dseqrecord): +class _Fragment(Dseqrecord): '''This class holds information about a DNA fragment in an assembly. This class is instantiated by the :class:`Assembly` class and is not meant to be instantiated directly. ''' - - def __init__(self, record, start1 = 0, + + def __init__(self, record, *args, + start1 = 0, end1 = 0, start2 = 0, end2 = 0, alignment = 0, - i = 0, *args, **kwargs): + i = 0, + **kwargs): - super(Fragment, self).__init__(record, *args, **kwargs) + super().__init__(record, *args, **kwargs) self.start1 = start1 self.end1 = end1 @@ -70,7 +72,7 @@ def __init__(self, record, start1 = 0, self.i = i def __str__(self): - return ("Fragment alignment {}\n").format(self.alignment)+super(Fragment, self).__str__() + return ("Fragment alignment {}\n").format(self.alignment)+super().__str__() class Contig(Dseqrecord): '''This class holds information about a DNA assembly. This class is instantiated by @@ -80,8 +82,9 @@ class Contig(Dseqrecord): def __init__(self, record, + *args, source_fragments=[], - *args, **kwargs): + **kwargs): super().__init__(record, *args, **kwargs) self.source_fragments = source_fragments @@ -89,6 +92,14 @@ def __init__(self, def __repr__(self): return "Contig({}{})".format({True:"-", False:"o"}[self.linear],len(self)) + + def _repr_pretty_(self, p, cycle): + '''returns a short string representation of the object''' + p.text("Contig({}{})".format({True:"-", False:"o"}[self.linear],len(self))) + + def _repr_html_(self): + return "
"+self.small_fig()+"
" + #"Contig({}{})".format({True:"-", False:"o"}[self.linear],len(self)) def detailed_figure(self): '''Synonym of :func:`detailed_fig`''' @@ -316,7 +327,7 @@ def __init__(self, dsrecs, limit = 25, only_terminal_overlaps=False, max_nodes=N setattr(self, key, value ) cache.close() - display(Markdown("```\n"+self.__repr__()+"```".replace('\n', '
'))) + #display(Markdown("```\n"+self.__repr__()+"```".replace('\n', '
'))) def _compare(self, cached): if str(self) != str(cached): @@ -436,7 +447,7 @@ def _assemble(self): olp2.location.start.position, olp2.location.end.position,) - source_fragment = Fragment(dsrec,s1,e1,s2,e2,i) + source_fragment = _Fragment(dsrec, start1=s1,end1=e1,start2=s2,end2=e2,i=i) #_Fragment(dsrec,s1,e1,s2,e2,i) self.G.add_edge( n1, n2, frag=source_fragment, @@ -499,19 +510,19 @@ def _assemble(self): for pth in all_circular_paths_edges(self.cG): - ns = min(enumerate(pth), key = lambda x:x[1][2]['i'])[0] + ns = min( enumerate(pth), key = lambda x:x[1][2]['i'] )[0] path = pth[ns:]+pth[:ns] pred_frag = copy(path[0][2]['frag']) source_fragments = [pred_frag, ] - + if pred_frag.start2{linktext}".format(item=self.item, start=self.start or "", stop=self.stop or "", strand=self.strand, linktext=linktext) -class Genbank(): +class Genbank(object): '''Class to facilitate download from genbank. Parameters @@ -98,8 +104,6 @@ def __init__(self, users_email, proxy = None, tool="pydna"): self.email=users_email #Always tell NCBI who you are - #print "#####", proxy - if proxy: parsed = urlparse(proxy) scheme = parsed.scheme @@ -122,7 +126,7 @@ def __init__(self, users_email, proxy = None, tool="pydna"): #urllib2.install_opener(self.opener) def __repr__(self): - return "Genbank({})".format(self.email) + return "GenbankConnection({})".format(self.email) def nucleotide(self, item, start=None, stop=None, strand="watson" ): '''Download a genbank nuclotide record. @@ -131,8 +135,8 @@ def nucleotide(self, item, start=None, stop=None, strand="watson" ): for a nucleotide file. Start and stop are intervals to be downloaded. This is useful as some genbank records are large. If strand is "c", "C", "crick", "Crick", "antisense","Antisense", - "2" or 2, the watson(antisense) strand is returned, otherwise - the sense strand is returned. + "2" or 2, the antisense (Crick) strand is returned, otherwise + the sense (Watson) strand is returned. Alternatively, item can be a string containing an url that returns a sequence in genbank or FASTA format. @@ -226,14 +230,16 @@ def nucleotide(self, item, start=None, stop=None, strand="watson" ): if self.email == "someone@example.com": raise ValueError("you have to set your email address in order to download from Genbank") - result = read(Entrez.efetch(db ="nucleotide", - id = item, - rettype = "gbwithparts", - seq_start = start, - seq_stop = stop, - strand = strand, - retmode = "text").read()) - + text = Entrez.efetch( db ="nucleotide", + id = item, + rettype = "gbwithparts", + seq_start = start, + seq_stop = stop, + strand = strand, + retmode = "text" ).read() + dsr = read(text) + result = GenbankRecord(dsr, item = item, start=start, stop=stop, strand=strand) + if os.environ["pydna_cache"] == "compare": if result!=cached: module_logger.warning('download error') @@ -241,13 +247,10 @@ def nucleotide(self, item, start=None, stop=None, strand="watson" ): if refresh or os.environ["pydna_cache"] == "refresh": cache = shelve.open(os.path.join(os.environ["pydna_data_dir"], "genbank"), protocol=pickle.HIGHEST_PROTOCOL, writeback=False) cache[key] = result, item, start, stop - elif cached and os.environ["pydna_cache"] not in ("nocache", "refresh"): result = cached cache.close() - - display(HTML("{item} {start}-{stop}".format(item=item, start=start, stop=stop))) - + return result def download_text(url, proxy = None): @@ -304,16 +307,30 @@ def download_text(url, proxy = None): return result +email = os.getenv("pydna_email") + +def genbank(accession, proxy=None): + gb = Genbank(email, proxy=proxy) + return gb.nucleotide(accession) + def read_url(url, proxy = None): + from pydna import PydnaDeprecationWarning + warnings.warn( "This function is obsolete; use download_text()" + "in combination with pydna.read instead", + BiopythonDeprecationWarning ) wb = Web(proxy=proxy) result = wb.download(url) return read(result) def parse_url(url, proxy = None): + from pydna import PydnaDeprecationWarning + warnings.warn( "This function is obsolete; use download_text()" + "in combination with pydna.parse instead", + BiopythonDeprecationWarning ) wb = Web(proxy=proxy) result = wb.download(url) return parse(result) if __name__=="__main__": import doctest - doctest.testmod() + doctest.testmod() \ No newline at end of file diff --git a/pydna/dsdna.py b/pydna/dsdna.py index fce23fb3..80ee8416 100644 --- a/pydna/dsdna.py +++ b/pydna/dsdna.py @@ -27,6 +27,7 @@ import math import glob import colorsys +import collections from warnings import warn @@ -1370,10 +1371,10 @@ class Dseqrecord(SeqRecord): ''' def __init__(self, record, + *args, circular = None, linear = None, n = 5E-14, # mol (0.05 pmol) - *args, **kwargs): self.n = n if circular == None and linear in (True, False,): @@ -1863,8 +1864,6 @@ def verify_stamp(self, chksum = (("SEGUID", seg),("cSEGUID", cseg))): else: return pretty_str(pattern) - - def looped(self): ''' Returns a circular version of the Dseqrecord object. The @@ -2006,7 +2005,7 @@ def write(self, filename=None, f="gb"): os.rename(filename, old_filename) result = ("

Sequence of pYPKa_TDH3_FaPDC_TPI1.gb changed from last save.


" "{old_filename}
").format(old_filename=old_filename) - display(HTML(result)) + #display(HTML(result)) else: raise Exception("filename has to be a string, got", type(filename)) @@ -2152,9 +2151,6 @@ def __repr__(self): return "Dseqrecord({}{})".format({True:"-", False:"o"}[self.linear],len(self)) def _repr_pretty_(self, p, cycle): - if cycle: - p.text('Dseqrecord(...)') - else: p.text("Dseqrecord({}{})".format({True:"-", False:"o"}[self.linear],len(self))) def __add__(self, other): @@ -2640,11 +2636,26 @@ def synced(self, ref, limit = 25): elif cached and os.environ["pydna_cache"] not in ("nocache", "refresh"): result = cached cache.close() - return result +class GenbankFile(Dseqrecord): + def __init__(self, record, *args, path=None, **kwargs): + super().__init__(record, *args, **kwargs) + self.path=path + + def __repr__(self): + '''returns a short string representation of the object''' + return "File({})({}{})".format(self.id, {True:"-", False:"o"}[self.linear],len(self)) + + def _repr_pretty_(self, p, cycle): + '''returns a short string representation of the object''' + p.text("File({})({}{})".format(self.id, {True:"-", False:"o"}[self.linear],len(self))) + + def _repr_html_(self): + return "{path}
".format(path=self.path) + def read(data, ds = True): '''This function is similar the :func:`parse` function but expects one and only @@ -2765,16 +2776,12 @@ def parse(data, ds = True): mode and parsed for EMBL, FASTA and Genbank sequences. - 2. an absolute path to a local directory. - All files in the directory will be - read and parsed as in 1. - - 3. a string containing one or more + 2. a string containing one or more sequences in EMBL, GENBANK, or FASTA format. Mixed formats are allowed. - 4. data can be a list or other iterable of 1 - 3 + 3. data can be a list or other iterable where the elements are 1 or 2 ds : bool If True double stranded :class:`Dseqrecord` objects are returned. @@ -2795,82 +2802,78 @@ def parse(data, ds = True): read ''' - raw= "" - - # a string is an iterable datatype but on Python2.x it doesn't have an __iter__ method. - if not hasattr(data, '__iter__') or isinstance(data, (str, bytes)): - data = (data,) - filenames = [] - for item in data: - #fn = os.path.join(dr, item ) - try: - with open(item, 'r', encoding="utf-8") as f: - raw+= f.read() - except IOError: - raw+=textwrap.dedent(item).strip() - else: - filenames.append(item) - - pattern = r"(?:>.+\n^(?:^[^>]+?)(?=\n\n|>|LOCUS|ID))|(?:(?:LOCUS|ID)(?:(?:.|\n)+?)^//)" - #raw = raw.replace( '\r\n', '\n') - #raw = raw.replace( '\r', '\n') - rawseqs = re.findall(pattern, textwrap.dedent(raw + "\n\n"), flags=re.MULTILINE) - sequences=[] - - while rawseqs: - circular = False - rawseq = rawseqs.pop(0) - handle = io.StringIO(rawseq) - try: - parsed = SeqIO.read(handle, "embl", alphabet=IUPACAmbiguousDNA()) - if "circular" in rawseq.splitlines()[0]: - circular = True - except ValueError: - handle.seek(0) + + def embl_gb_fasta(raw, ds, path=None): + + pattern = r"(?:>.+\n^(?:^[^>]+?)(?=\n\n|>|LOCUS|ID))|(?:(?:LOCUS|ID)(?:(?:.|\n)+?)^//)" + + result_list = [] + + rawseqs = re.findall(pattern, textwrap.dedent(raw + "\n\n"), flags=re.MULTILINE) + + for rawseq in rawseqs: + handle = io.StringIO(rawseq) + circular=False try: - parsed = SeqIO.read(handle, "genbank", alphabet=IUPACAmbiguousDNA()) - handle.seek(0) - parser = RecordParser() - residue_type = parser.parse(handle).residue_type - if "circular" in residue_type: + parsed = SeqIO.read(handle, "embl", alphabet=IUPACAmbiguousDNA()) + if "circular" in rawseq.splitlines()[0]: circular = True except ValueError: handle.seek(0) try: - parsed = SeqIO.read(handle, "fasta", alphabet=IUPACAmbiguousDNA()) - if "circular" in rawseq.splitlines()[0]: + parsed = SeqIO.read(handle, "genbank", alphabet=IUPACAmbiguousDNA()) + handle.seek(0) + parser = RecordParser() + residue_type = parser.parse(handle).residue_type + if "circular" in residue_type: circular = True except ValueError: - continue + handle.seek(0) + try: + parsed = SeqIO.read(handle, "fasta", alphabet=IUPACAmbiguousDNA()) + if "circular" in rawseq.splitlines()[0]: + circular = True + except ValueError: + parsed = "" + handle.close() + + if ds and path: + result_list.append( GenbankFile(parsed, circular=circular, path=path) ) + elif ds: + result_list.append( Dseqrecord(parsed, circular =circular) ) + else: + result_list.append( parsed ) + + return result_list - if ds: - sequences.append( Dseqrecord(parsed, circular = circular) ) - else: - sequences.append( parsed ) - handle.close() - if filenames: - msg="" - for fn in filenames: - msg += "{fn}
".format(fn=fn) - display(HTML(msg)) + # a string is an iterable datatype but on Python2.x it doesn't have an __iter__ method. + if not hasattr(data, '__iter__') or isinstance(data, (str, bytes)): + data = (data,) + + sequences = [] + + for item in data: + try: + # item is a path to a utf-8 encoded text file? + with open(item, 'r', encoding="utf-8") as f: + raw = f.read() + except IOError: + # item was not a path, add sequences parsed from item + raw=item + path=None + else: + # item was a readable text file, seqences are parsed from the file + path = item + finally: + sequences.extend(embl_gb_fasta(raw, ds, path) ) + return sequences - #http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi? - #db=nuccore& - #id=21614549& - #strand=1& - #seq_start=1& - #seq_stop=100& - #rettype=gb& - #retmode=text - def parse_primers(data): return parse(data, ds=False) def read_primer(data): return read(data, ds=False) - - if __name__=="__main__": import doctest diff --git a/pydna/primer_design.py b/pydna/primer_design.py index 1893a2e9..187cc3c6 100644 --- a/pydna/primer_design.py +++ b/pydna/primer_design.py @@ -292,7 +292,7 @@ def cloning_primers( template, with open(path, 'a') as f: f.write("\n"+rp.format("fasta").strip()) msg = ("\n"+fp.format("fasta")+"\n"+rp.format("fasta")+"\n").replace('\n', '
') - display(HTML(msg)) + #display(HTML(msg)) return fp, rp def integration_primers( up, diff --git a/run_test.py b/run_test.py index b46aa5f7..c400cc16 100755 --- a/run_test.py +++ b/run_test.py @@ -53,6 +53,13 @@ def main(): else: del coveralls args = ["--cov=pydna", "--cov-report=html", "--cov-report=xml"] + try: + import nbval + except ImportError: + print("nbval NOT installed!") + else: + del nbval + args.append("--nbval") args = [".", "-v", "-s"] + args cwd = os.getcwd() diff --git a/tests/.ipynb_checkpoints/jupyter_test_repr-checkpoint.ipynb b/tests/.ipynb_checkpoints/jupyter_test_repr-checkpoint.ipynb new file mode 100755 index 00000000..0031e19a --- /dev/null +++ b/tests/.ipynb_checkpoints/jupyter_test_repr-checkpoint.ipynb @@ -0,0 +1,881 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "# This notebook shows rich jupyter representations of Dseqrecord and derived classes\n", + "\n", + "* Dseqrecord --> base class\n", + "* GenbankRecord(Dseqrecord) --> read from Genbank link\n", + "* GenbankFile(Dseqrecord) --> read from local file\n", + "* Amplicon(Dseqrecord) --> PCR product\n", + "* Contig(Dseqrecord) --> Produced through Assembly " + ] + }, + { + "cell_type": "code", + "execution_count": 1, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "import pydna" + ] + }, + { + "cell_type": "code", + "execution_count": 2, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "ldsr = pydna.Dseqrecord(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 3, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.Dseqrecord" + ] + }, + "execution_count": 3, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(ldsr)" + ] + }, + { + "cell_type": "code", + "execution_count": 4, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Dseqrecord(-3)" + ] + }, + "execution_count": 4, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "ldsr" + ] + }, + { + "cell_type": "code", + "execution_count": 5, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "cdsr = pydna.Dseqrecord(\"aaa\", circular=True)" + ] + }, + { + "cell_type": "code", + "execution_count": 6, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.Dseqrecord" + ] + }, + "execution_count": 6, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(cdsr)" + ] + }, + { + "cell_type": "code", + "execution_count": 7, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Dseqrecord(o3)" + ] + }, + "execution_count": 7, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "cdsr" + ] + }, + { + "cell_type": "code", + "execution_count": 8, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "fromstring = pydna.read(\">string\\naaaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 9, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.Dseqrecord" + ] + }, + "execution_count": 9, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(fromstring)" + ] + }, + { + "cell_type": "code", + "execution_count": 10, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Dseqrecord(-4)" + ] + }, + "execution_count": 10, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "fromstring" + ] + }, + { + "cell_type": "code", + "execution_count": 11, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "from pydna.download import GenbankRecord" + ] + }, + { + "cell_type": "code", + "execution_count": 12, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "gbr = GenbankRecord(\"aaa\", circular=True)" + ] + }, + { + "cell_type": "code", + "execution_count": 13, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "" + ], + "text/plain": [ + "Genbank(-)(o3)" + ] + }, + "execution_count": 13, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 14, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "gbr = pydna.genbank(\"E05006\")" + ] + }, + { + "cell_type": "code", + "execution_count": 15, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "E05006" + ], + "text/plain": [ + "Genbank(E05006.1)(-25)" + ] + }, + "execution_count": 15, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 16, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "gbr = pydna.genbank(\"E05006 REGION: 5..15\")" + ] + }, + { + "cell_type": "code", + "execution_count": 17, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "E05006 5-15" + ], + "text/plain": [ + "Genbank(E05006.1)(-11)" + ] + }, + "execution_count": 17, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 18, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbr = pydna.genbank(\"E05006 REGION: complement(5..15)\")" + ] + }, + { + "cell_type": "code", + "execution_count": 19, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "E05006 5-15" + ], + "text/plain": [ + "Genbank(E05006.1)(-11)" + ] + }, + "execution_count": 19, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 20, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "from pydna.dsdna import GenbankFile" + ] + }, + { + "cell_type": "code", + "execution_count": 21, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbf=GenbankFile(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 22, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "None
" + ], + "text/plain": [ + "File(-)(-3)" + ] + }, + "execution_count": 22, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbf" + ] + }, + { + "cell_type": "code", + "execution_count": 23, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbf = pydna.read(\"sequence.gb\")" + ] + }, + { + "cell_type": "code", + "execution_count": 24, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.GenbankFile" + ] + }, + "execution_count": 24, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(gbf)" + ] + }, + { + "cell_type": "code", + "execution_count": 25, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "sequence.gb
" + ], + "text/plain": [ + "File(E05006.1)(-25)" + ] + }, + "execution_count": 25, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbf" + ] + }, + { + "cell_type": "code", + "execution_count": 26, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbf = pydna.read(\"subfolder/sequence.gb\")" + ] + }, + { + "cell_type": "code", + "execution_count": 27, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.GenbankFile" + ] + }, + "execution_count": 27, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(gbf)" + ] + }, + { + "cell_type": "code", + "execution_count": 28, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "subfolder/sequence.gb
" + ], + "text/plain": [ + "File(E05006.1)(-25)" + ] + }, + "execution_count": 28, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbf" + ] + }, + { + "cell_type": "code", + "execution_count": 29, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "from pydna.amplify import Amplicon" + ] + }, + { + "cell_type": "code", + "execution_count": 30, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "amp = Amplicon(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 31, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.amplify.Amplicon" + ] + }, + "execution_count": 31, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(amp)" + ] + }, + { + "cell_type": "code", + "execution_count": 32, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "Amplicon(3)" + ], + "text/plain": [ + "Amplicon(3)" + ] + }, + "execution_count": 32, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "amp" + ] + }, + { + "cell_type": "code", + "execution_count": 33, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "import pydna\n", + "primers = pydna.parse_primers('''>ForwardPrimer\n", + "gctactacacacgtactgactg\n", + ">ReversePrimer\n", + "tgtggttactgactctatcttg ''')\n", + "temp = pydna.Dseqrecord(\"gctactacacacgtactgactgcctccaagatagagtcagtaaccaca\")\n", + "prd = pydna.pcr(primers, temp)" + ] + }, + { + "cell_type": "code", + "execution_count": 34, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.amplify.Amplicon" + ] + }, + "execution_count": 34, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(prd)" + ] + }, + { + "cell_type": "code", + "execution_count": 35, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "Amplicon(48)" + ], + "text/plain": [ + "Amplicon(48)" + ] + }, + "execution_count": 35, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "prd" + ] + }, + { + "cell_type": "code", + "execution_count": 36, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "5gctactacacacgtactgactg...caagatagagtcagtaaccaca3\n", + " |||||||||||||||||||||| tm 54.6 (dbd) 57.7\n", + " 3gttctatctcagtcattggtgt5\n", + "5gctactacacacgtactgactg3\n", + " |||||||||||||||||||||| tm 57.9 (dbd) 58.3\n", + "3cgatgatgtgtgcatgactgac...gttctatctcagtcattggtgt5" + ] + }, + "execution_count": 36, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "prd.figure()" + ] + }, + { + "cell_type": "code", + "execution_count": 37, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "(Amplicon(48), Amplicon(48))" + ] + }, + "execution_count": 37, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "(prd, prd)" + ] + }, + { + "cell_type": "code", + "execution_count": 38, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "from pydna.assembly import Contig" + ] + }, + { + "cell_type": "code", + "execution_count": 39, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "cnt = Contig(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 40, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.assembly.Contig" + ] + }, + "execution_count": 40, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(cnt)" + ] + }, + { + "cell_type": "code", + "execution_count": 41, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "a = pydna.Dseqrecord(\"acgatgctatactgCCCCCtgtgctgtgctcta\", name=\"SequenceA\")\n", + "b = pydna.Dseqrecord(\"tgtgctgtgctctaTTTTTtattctggctgtatc\", name=\"SequenceB\")\n", + "c = pydna.Dseqrecord(\"tattctggctgtatcGGGGGtacgatgctatact\", name=\"SequenceC\")\n", + "x = pydna.Assembly((a,b,c), limit=13)" + ] + }, + { + "cell_type": "code", + "execution_count": 42, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Assembly:\n", + "Sequences........................: [33] [34] [34]\n", + "Sequences with shared homologies.: [33] [34] [34]\n", + "Homology limit (bp)..............: 13\n", + "Number of overlaps...............: 3\n", + "Nodes in graph(incl. 5' & 3')....: 5\n", + "Only terminal overlaps...........: No\n", + "Circular products................: [59]\n", + "Linear products..................: [74] [73] [72] [54] [53] [53] [15] [14] [13]" + ] + }, + "execution_count": 42, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "x" + ] + }, + { + "cell_type": "code", + "execution_count": 43, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "cnt = x.circular_products[0]" + ] + }, + { + "cell_type": "code", + "execution_count": 44, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.assembly.Contig" + ] + }, + "execution_count": 44, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(cnt)" + ] + }, + { + "cell_type": "code", + "execution_count": 45, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "
 -|SequenceA|14\n",
+       "|            \\/\n",
+       "|            /\\\n",
+       "|            14|SequenceB|15\n",
+       "|                         \\/\n",
+       "|                         /\\\n",
+       "|                         15|SequenceC|13\n",
+       "|                                      \\/\n",
+       "|                                      /\\\n",
+       "|                                      13-\n",
+       "|                                         |\n",
+       " -----------------------------------------
" + ], + "text/plain": [ + "Contig(o59)" + ] + }, + "execution_count": 45, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "cnt" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [] + } + ], + "metadata": { + "anaconda-cloud": {}, + "kernelspec": { + "display_name": "Python 3", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.5.2" + } + }, + "nbformat": 4, + "nbformat_minor": 0 +} diff --git a/tests/jupyter_test_repr.ipynb b/tests/jupyter_test_repr.ipynb new file mode 100755 index 00000000..0031e19a --- /dev/null +++ b/tests/jupyter_test_repr.ipynb @@ -0,0 +1,881 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "metadata": {}, + "source": [ + "# This notebook shows rich jupyter representations of Dseqrecord and derived classes\n", + "\n", + "* Dseqrecord --> base class\n", + "* GenbankRecord(Dseqrecord) --> read from Genbank link\n", + "* GenbankFile(Dseqrecord) --> read from local file\n", + "* Amplicon(Dseqrecord) --> PCR product\n", + "* Contig(Dseqrecord) --> Produced through Assembly " + ] + }, + { + "cell_type": "code", + "execution_count": 1, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "import pydna" + ] + }, + { + "cell_type": "code", + "execution_count": 2, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "ldsr = pydna.Dseqrecord(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 3, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.Dseqrecord" + ] + }, + "execution_count": 3, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(ldsr)" + ] + }, + { + "cell_type": "code", + "execution_count": 4, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Dseqrecord(-3)" + ] + }, + "execution_count": 4, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "ldsr" + ] + }, + { + "cell_type": "code", + "execution_count": 5, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "cdsr = pydna.Dseqrecord(\"aaa\", circular=True)" + ] + }, + { + "cell_type": "code", + "execution_count": 6, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.Dseqrecord" + ] + }, + "execution_count": 6, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(cdsr)" + ] + }, + { + "cell_type": "code", + "execution_count": 7, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Dseqrecord(o3)" + ] + }, + "execution_count": 7, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "cdsr" + ] + }, + { + "cell_type": "code", + "execution_count": 8, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "fromstring = pydna.read(\">string\\naaaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 9, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.Dseqrecord" + ] + }, + "execution_count": 9, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(fromstring)" + ] + }, + { + "cell_type": "code", + "execution_count": 10, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Dseqrecord(-4)" + ] + }, + "execution_count": 10, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "fromstring" + ] + }, + { + "cell_type": "code", + "execution_count": 11, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "from pydna.download import GenbankRecord" + ] + }, + { + "cell_type": "code", + "execution_count": 12, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "gbr = GenbankRecord(\"aaa\", circular=True)" + ] + }, + { + "cell_type": "code", + "execution_count": 13, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "" + ], + "text/plain": [ + "Genbank(-)(o3)" + ] + }, + "execution_count": 13, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 14, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "gbr = pydna.genbank(\"E05006\")" + ] + }, + { + "cell_type": "code", + "execution_count": 15, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "E05006" + ], + "text/plain": [ + "Genbank(E05006.1)(-25)" + ] + }, + "execution_count": 15, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 16, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "gbr = pydna.genbank(\"E05006 REGION: 5..15\")" + ] + }, + { + "cell_type": "code", + "execution_count": 17, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "E05006 5-15" + ], + "text/plain": [ + "Genbank(E05006.1)(-11)" + ] + }, + "execution_count": 17, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 18, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbr = pydna.genbank(\"E05006 REGION: complement(5..15)\")" + ] + }, + { + "cell_type": "code", + "execution_count": 19, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "E05006 5-15" + ], + "text/plain": [ + "Genbank(E05006.1)(-11)" + ] + }, + "execution_count": 19, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbr" + ] + }, + { + "cell_type": "code", + "execution_count": 20, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "from pydna.dsdna import GenbankFile" + ] + }, + { + "cell_type": "code", + "execution_count": 21, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbf=GenbankFile(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 22, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "None
" + ], + "text/plain": [ + "File(-)(-3)" + ] + }, + "execution_count": 22, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbf" + ] + }, + { + "cell_type": "code", + "execution_count": 23, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbf = pydna.read(\"sequence.gb\")" + ] + }, + { + "cell_type": "code", + "execution_count": 24, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.GenbankFile" + ] + }, + "execution_count": 24, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(gbf)" + ] + }, + { + "cell_type": "code", + "execution_count": 25, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "sequence.gb
" + ], + "text/plain": [ + "File(E05006.1)(-25)" + ] + }, + "execution_count": 25, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbf" + ] + }, + { + "cell_type": "code", + "execution_count": 26, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "gbf = pydna.read(\"subfolder/sequence.gb\")" + ] + }, + { + "cell_type": "code", + "execution_count": 27, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.dsdna.GenbankFile" + ] + }, + "execution_count": 27, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(gbf)" + ] + }, + { + "cell_type": "code", + "execution_count": 28, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "subfolder/sequence.gb
" + ], + "text/plain": [ + "File(E05006.1)(-25)" + ] + }, + "execution_count": 28, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "gbf" + ] + }, + { + "cell_type": "code", + "execution_count": 29, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "from pydna.amplify import Amplicon" + ] + }, + { + "cell_type": "code", + "execution_count": 30, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "amp = Amplicon(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 31, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.amplify.Amplicon" + ] + }, + "execution_count": 31, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(amp)" + ] + }, + { + "cell_type": "code", + "execution_count": 32, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "Amplicon(3)" + ], + "text/plain": [ + "Amplicon(3)" + ] + }, + "execution_count": 32, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "amp" + ] + }, + { + "cell_type": "code", + "execution_count": 33, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "import pydna\n", + "primers = pydna.parse_primers('''>ForwardPrimer\n", + "gctactacacacgtactgactg\n", + ">ReversePrimer\n", + "tgtggttactgactctatcttg ''')\n", + "temp = pydna.Dseqrecord(\"gctactacacacgtactgactgcctccaagatagagtcagtaaccaca\")\n", + "prd = pydna.pcr(primers, temp)" + ] + }, + { + "cell_type": "code", + "execution_count": 34, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.amplify.Amplicon" + ] + }, + "execution_count": 34, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(prd)" + ] + }, + { + "cell_type": "code", + "execution_count": 35, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "Amplicon(48)" + ], + "text/plain": [ + "Amplicon(48)" + ] + }, + "execution_count": 35, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "prd" + ] + }, + { + "cell_type": "code", + "execution_count": 36, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "5gctactacacacgtactgactg...caagatagagtcagtaaccaca3\n", + " |||||||||||||||||||||| tm 54.6 (dbd) 57.7\n", + " 3gttctatctcagtcattggtgt5\n", + "5gctactacacacgtactgactg3\n", + " |||||||||||||||||||||| tm 57.9 (dbd) 58.3\n", + "3cgatgatgtgtgcatgactgac...gttctatctcagtcattggtgt5" + ] + }, + "execution_count": 36, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "prd.figure()" + ] + }, + { + "cell_type": "code", + "execution_count": 37, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "(Amplicon(48), Amplicon(48))" + ] + }, + "execution_count": 37, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "(prd, prd)" + ] + }, + { + "cell_type": "code", + "execution_count": 38, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "from pydna.assembly import Contig" + ] + }, + { + "cell_type": "code", + "execution_count": 39, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "cnt = Contig(\"aaa\")" + ] + }, + { + "cell_type": "code", + "execution_count": 40, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.assembly.Contig" + ] + }, + "execution_count": 40, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(cnt)" + ] + }, + { + "cell_type": "code", + "execution_count": 41, + "metadata": { + "collapsed": false + }, + "outputs": [], + "source": [ + "a = pydna.Dseqrecord(\"acgatgctatactgCCCCCtgtgctgtgctcta\", name=\"SequenceA\")\n", + "b = pydna.Dseqrecord(\"tgtgctgtgctctaTTTTTtattctggctgtatc\", name=\"SequenceB\")\n", + "c = pydna.Dseqrecord(\"tattctggctgtatcGGGGGtacgatgctatact\", name=\"SequenceC\")\n", + "x = pydna.Assembly((a,b,c), limit=13)" + ] + }, + { + "cell_type": "code", + "execution_count": 42, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "Assembly:\n", + "Sequences........................: [33] [34] [34]\n", + "Sequences with shared homologies.: [33] [34] [34]\n", + "Homology limit (bp)..............: 13\n", + "Number of overlaps...............: 3\n", + "Nodes in graph(incl. 5' & 3')....: 5\n", + "Only terminal overlaps...........: No\n", + "Circular products................: [59]\n", + "Linear products..................: [74] [73] [72] [54] [53] [53] [15] [14] [13]" + ] + }, + "execution_count": 42, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "x" + ] + }, + { + "cell_type": "code", + "execution_count": 43, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [ + "cnt = x.circular_products[0]" + ] + }, + { + "cell_type": "code", + "execution_count": 44, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/plain": [ + "pydna.assembly.Contig" + ] + }, + "execution_count": 44, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "type(cnt)" + ] + }, + { + "cell_type": "code", + "execution_count": 45, + "metadata": { + "collapsed": false + }, + "outputs": [ + { + "data": { + "text/html": [ + "
 -|SequenceA|14\n",
+       "|            \\/\n",
+       "|            /\\\n",
+       "|            14|SequenceB|15\n",
+       "|                         \\/\n",
+       "|                         /\\\n",
+       "|                         15|SequenceC|13\n",
+       "|                                      \\/\n",
+       "|                                      /\\\n",
+       "|                                      13-\n",
+       "|                                         |\n",
+       " -----------------------------------------
" + ], + "text/plain": [ + "Contig(o59)" + ] + }, + "execution_count": 45, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "cnt" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "collapsed": true + }, + "outputs": [], + "source": [] + } + ], + "metadata": { + "anaconda-cloud": {}, + "kernelspec": { + "display_name": "Python 3", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.5.2" + } + }, + "nbformat": 4, + "nbformat_minor": 0 +} diff --git a/tests/sequence.gb b/tests/sequence.gb new file mode 100644 index 00000000..aa100f84 --- /dev/null +++ b/tests/sequence.gb @@ -0,0 +1,41 @@ +LOCUS E05006 25 bp DNA linear PAT 04-NOV-2005 +DEFINITION PCR primer to generate NcoI and SphI site adjacent to T7 promoter + on pGEMEX2. +ACCESSION E05006 +VERSION E05006.1 +KEYWORDS JP 1993105699-A/1. +SOURCE synthetic construct + ORGANISM synthetic construct + other sequences; artificial sequences. +REFERENCE 1 (bases 1 to 25) + AUTHORS Mori,T., Takada,T., Koike,K. and Sugano,H. + TITLE PRODUCTION OF B TYPE HEPATITIS VIRUS X PROTEIN AND DIAGNOSTIC AGENT + USING THE SAME + JOURNAL Patent: JP 1993105699-A 1 27-APR-1993; + JAPAN FOUND CANCER RES, MEIJI MILK PROD CO LTD +COMMENT OS Artificial gene + OC Artificial sequence; Genes. + PN JP 1993105699-A/1 + PD 27-APR-1993 + PF 07-AUG-1991 JP 1991198008 + PI MORI TAKESHI, TAKADA TOMOKO, KOIKE KATSURO, SUGANO HARUO PC + C07K15/04,A61K39/29,C12N15/51,C12P21/02,G01N33/53,G01N33/569, PC + G01N33/576, + PC (C12P21/02,C12R1:19); + CC strandedness: Double; + CC topology: Linear; + FH Key Location/Qualifiers + FH + FT misc_feature 1..25 + FT /note='PCR primer to generate NcoI and SphI + FT site adjacent + FT to T7 promoter on pGEMEX2'. +FEATURES Location/Qualifiers + source 1..25 + /organism="synthetic construct" + /mol_type="unassigned DNA" + /db_xref="taxon:32630" +ORIGIN + 1 atatgggtac cgatcgtacg gacca +// + diff --git a/tests/subfolder/sequence.gb b/tests/subfolder/sequence.gb new file mode 100644 index 00000000..aa100f84 --- /dev/null +++ b/tests/subfolder/sequence.gb @@ -0,0 +1,41 @@ +LOCUS E05006 25 bp DNA linear PAT 04-NOV-2005 +DEFINITION PCR primer to generate NcoI and SphI site adjacent to T7 promoter + on pGEMEX2. +ACCESSION E05006 +VERSION E05006.1 +KEYWORDS JP 1993105699-A/1. +SOURCE synthetic construct + ORGANISM synthetic construct + other sequences; artificial sequences. +REFERENCE 1 (bases 1 to 25) + AUTHORS Mori,T., Takada,T., Koike,K. and Sugano,H. + TITLE PRODUCTION OF B TYPE HEPATITIS VIRUS X PROTEIN AND DIAGNOSTIC AGENT + USING THE SAME + JOURNAL Patent: JP 1993105699-A 1 27-APR-1993; + JAPAN FOUND CANCER RES, MEIJI MILK PROD CO LTD +COMMENT OS Artificial gene + OC Artificial sequence; Genes. + PN JP 1993105699-A/1 + PD 27-APR-1993 + PF 07-AUG-1991 JP 1991198008 + PI MORI TAKESHI, TAKADA TOMOKO, KOIKE KATSURO, SUGANO HARUO PC + C07K15/04,A61K39/29,C12N15/51,C12P21/02,G01N33/53,G01N33/569, PC + G01N33/576, + PC (C12P21/02,C12R1:19); + CC strandedness: Double; + CC topology: Linear; + FH Key Location/Qualifiers + FH + FT misc_feature 1..25 + FT /note='PCR primer to generate NcoI and SphI + FT site adjacent + FT to T7 promoter on pGEMEX2'. +FEATURES Location/Qualifiers + source 1..25 + /organism="synthetic construct" + /mol_type="unassigned DNA" + /db_xref="taxon:32630" +ORIGIN + 1 atatgggtac cgatcgtacg gacca +// + diff --git a/tests/test_assemble_pGUP1.py b/tests/test_assemble_pGUP1.py index 630de582..dd995cad 100644 --- a/tests/test_assemble_pGUP1.py +++ b/tests/test_assemble_pGUP1.py @@ -4,10 +4,9 @@ test pGUP1 ''' import pytest -import sys import pydna -def test_empty(): +def test_assemble_pGUP1(): ''' test pGUP1''' GUP1rec1sens = pydna.read("GUP1rec1sens.txt") @@ -36,4 +35,4 @@ def test_empty(): assert pGUP1.seguid() == "42wIByERn2kSe_Exn405RYwhffU" if __name__ == '__main__': - pytest.cmdline.main([__file__, "-v", "-s"]) + pytest.cmdline.main([__file__, "-v", "-s"]) \ No newline at end of file diff --git a/tests/test_download.py b/tests/test_download.py index 0968eed1..3ab38078 100644 --- a/tests/test_download.py +++ b/tests/test_download.py @@ -2,7 +2,6 @@ # -*- coding: utf-8 -*- import os -import sys import pytest import pydna