Home
- Tested on python 3.6.10
- For local blastn searches, NCBI BLAST+ executables (specifically
blastn) must be installed and in the system path
Required python modules
- click (v7.1.2)
- matplotlib (v3.3.0)
- pandas (v0.25.3)
- seaborn (v0.10.1)
Usage: mitohelper.py [OPTIONS] COMMAND [ARGS]...
Options:
--help Show this message and exit.
Commands:
getalignment Pairwise align input sequences against a reference
getrecord Retrieve fish mitochondrial records from taxa list
Usage: mitohelper.py getalignment [OPTIONS]
Pairwise align input sequences against a reference
Options:
-i, --input_file TEXT Input file: either blast output file or FASTA
file [required]
-o, --output_prefix TEXT Output prefix (e.g. OUT) [required]
-r, --reference_sequence TEXT FASTA file of a single reference sequence for
blastn searches. Required for --blast option.
--blast / --no-blast Perform local blastn-short searches to
extract alignment positions (default=FALSE)
--help Show this message and exit.
Screen output example:
==== Run complete! ===
blastn output saved in OUT.blastn.txt
Table of alignment positions saved in OUT.alnpositions.tsv
Plot of alignment positions saved in OUT.alnpositions.pdf
blastn input/output (```-outfmt7```):
Fields: query acc.ver, subject acc.ver, % identity, alignment length, mismatches, gap opens, q. start, q. end, s. start, s. end, evalue, bit score
AB938103 NC_002333.2:1020-1971 93.750 16 1 0 2 17 249 264 0.008 24.3 AB938103 NC_002333.2:1020-1971 100.000 12 0 0 94 105 337 348 0.008 24.3 AB938103 NC_002333.2:1020-1971 89.474 19 2 0 38 56 285 303 0.032 22.3 AB938103 NC_002333.2:1020-1971 100.000 9 0 0 2 10 256 248 0.49 18.3 AB938103 NC_002333.2:1020-1971 100.000 9 0 0 49 57 476 468 0.49 18.3 AB938103 NC_002333.2:1020-1971 100.000 9 0 0 149 157 300 308 0.49 18.3 AB938103 NC_002333.2:1020-1971 100.000 9 0 0 64 72 332 340 0.49 18.3
TSV output - Reference sequence on top:
Accession Start End
NC_002333.2:1020-1971 1 952
AB006953 1 945
AB015962 421 733
AB016274 547 637
AB018224 170 304
AB018225 170 304
AB018226 170 304
AB018227 150 305
AB018228 150 305
AB018229 150 305
AB018230 150 305
PDF output - Reference sequence on top:
Usage: mitohelper.py getrecord [OPTIONS]
Retrieve fish mitochondrial records from taxa list
Options:
-i, --input_file TEXT Input query file (e.g. input.txt)
[required]
-o, --output_prefix TEXT Output prefix (e.g. OUT) [required]
-d, --database_file TEXT Database file (e.g. mitofish.all.Jul2020.tsv
[required]
-l, --tax_level [1|2|3|4|5|6|7]
The taxonomic level of the search (e.g 7 for
species, 6 for genus etc)
--fasta / --no-fasta Generate FASTA file output containing
sequences of all matching hits
(default=FALSE)
--help Show this message and exit.
Reference database files:
- mitofish.all.Jul2020.tsv (639,987 records; Jul 2020 update)
- mitofish.12S.Jul2020.tsv (34,558 records)
- mitofish.COI.Jul2020.tsv (189,956 records)
Input file example:
Abraliopsis pfefferi
Ahliesaurus berryi
Alepisaurus FEROX
anotopterus pharao
Screen output example:
=== Searching query #1: <Abraliopsis pfefferi> ===
=== Searching query #2: <Ahliesaurus berryi> ===
Search string:Notosudidae Taxonomic level:L5 Hits:55
=== Searching query #3: <Alepisaurus FEROX> ===
Search string:Alepisauridae Taxonomic level:L5 Hits:79
=== Searching query #4: <anotopterus pharao> ===
DUPLICATE WARNING: Query has already been processed!
Output file example (e.g. OUT_L5_hits.tsv):
Query Accession Gene definition txid Superkingdom Phylum Class Order Family Genus Species Sequence
Notosudidae AP004201 Scopelosaurus hoedti mitochondrial DNA, almost complete genome 172128 Eukaryota Chordata Actinopteri Au
lopiformes Notosudidae Scopelosaurus Scopelosaurus hoedti GCTAACGTAGTTTACTAAAAATATGACTCTGAAGAAGTTAAGACAGACCCTGAGAAGGCCTCGTAAGCACAAAAGCTTGGTC
CTGGCTTTACTGTCATCTCAAACCGAGCTTACACATGCAAGTCTCCGCACCCCTGTGAGGATGCCCTCCACCCTCCTTTCCGGAAACGAGGAGCCGGTATCAGGCACGCCTATCAAGGCAGCCCAAAACACCTTGCTCAGCCACACCCCCAAGG
GATTTCAGCAGTGATAGACATTAAGCAATAAGTGAAAACTTGACTTAGTTAAGGTTTAACAGGGCCGGTCAACCTCGTGCCAGCCGCCGCGGT