-
Notifications
You must be signed in to change notification settings - Fork 9
Home
shenjean edited this page Jul 30, 2020
·
50 revisions
Welcome to the getMito wiki! This wiki describes the workflow used to create the reference database file(s) used in getMito. Click on each section in the navigation pane on the right for details.
The getMito Wiki page describes the creation of reference database files.
Usage: getMito.py [OPTIONS]
From a user-provided list of fish taxonomic names, getMito extracts
available mitochondrial information and FASTA file (optional) at user-specified taxonomic levels.
The reference database is prepared from the MitoFish database and NCBI (Jul 2020 update).
Options:
-i, --input_file TEXT Input query file (e.g. input.txt) [required]
-o, --output_prefix TEXT Output prefix (e.g. OUT) [required]
-d, --database_file TEXT Database file (e.g. mitofish.all.Jul2020.tsv) [required]
-l, --tax_level [1|2|3|4|5|6|7] The taxonomic level of the search (e.g. 7 for speecies search, 6 for genus search)
--fasta / --no-fasta Generate FASTA file containing sequences of all matching hits (default=FALSE)
--help Show this message and exit.
Dependencies: Python3 and the conda- and pip-installable click package
Reference database files: Reference database files:
- mitofish.all.Jul2020.tsv (639,987 records; Jul 2020 update)
- mitofish.12S.Jul2020.tsv (34,558 records)
- mitofish.COI.Jul2020.tsv (189,956 records)
Input file example:
Abraliopsis pfefferi
Ahliesaurus berryi
Alepisaurus FEROX
anotopterus pharao
Screen output example:
=== Searching query #1: <Abraliopsis pfefferi> ===
=== Searching query #2: <Ahliesaurus berryi> ===
Search string:Notosudidae Taxonomic level:L5 Hits:55
=== Searching query #3: <Alepisaurus FEROX> ===
Search string:Alepisauridae Taxonomic level:L5 Hits:79
=== Searching query #4: <anotopterus pharao> ===
DUPLICATE WARNING: Query has already been processed!
Output file example (e.g. OUT_L5_hits.tsv):
Query Accession Gene definition txid Superkingdom Phylum Class Order Family Genus Species Sequence
Notosudidae AP004201 Scopelosaurus hoedti mitochondrial DNA, almost complete genome 172128 Eukaryota Chordata Actinopteri Au
lopiformes Notosudidae Scopelosaurus Scopelosaurus hoedti GCTAACGTAGTTTACTAAAAATATGACTCTGAAGAAGTTAAGACAGACCCTGAGAAGGCCTCGTAAGCACAAAAGCTTGGTC
CTGGCTTTACTGTCATCTCAAACCGAGCTTACACATGCAAGTCTCCGCACCCCTGTGAGGATGCCCTCCACCCTCCTTTCCGGAAACGAGGAGCCGGTATCAGGCACGCCTATCAAGGCAGCCCAAAACACCTTGCTCAGCCACACCCCCAAGG
GATTTCAGCAGTGATAGACATTAAGCAATAAGTGAAAACTTGACTTAGTTAAGGTTTAACAGGGCCGGTCAACCTCGTGCCAGCCGCCGCGGT