> suppressPackageStartupMessages({
+   library(Biostrings)
+   library(BSgenome)
+   library(GenomicRanges)
+ })
> (genome <- DNAStringSet(c(
+   chr1 = paste(sample(c("C", "G", "A", "T"), 100, replace = TRUE), collapse = ""), 
+   chr2 = paste(sample(c("C", "G", "A", "T"), 100, replace = TRUE), collapse = "")
+ )))
  A DNAStringSet instance of length 2
    width seq                                              names               
[1]   100 GGCTCGAAAACATGGAATCTAGC...TAGCAACCCGCGGAGCCGCAAG chr1
[2]   100 TTGGGCTAACGAGAGACACGAAG...TAGAGCGAGGTTCTCTAATACG chr2
> gtf <- GRanges(
+   seqnames = c("chr1", "chr1", "chr2", "chr2"), 
+   ranges = IRanges(start = c(3, 10, 50, 70), 
+                    end = c(15, 20, 70, 80)), 
+   strand = c("+", "-", "+", "-")
+ )
> names(gtf) <- paste0("E", 1:4)
> gtf
GRanges object with 4 ranges and 0 metadata columns:
     seqnames    ranges strand
        <Rle> <IRanges>  <Rle>
  E1     chr1      3-15      +
  E2     chr1     10-20      -
  E3     chr2     50-70      +
  E4     chr2     70-80      -
  -------
  seqinfo: 2 sequences from an unspecified genome; no seqlengths
> ## Extract sequences - all good
> (gs <- getSeq(x = genome, names = gtf))
  A DNAStringSet instance of length 4
    width seq                                              names               
[1]    13 CTCGAAAACATGG                                    E1
[2]    11 AGATTCCATGT                                      E2
[3]    21 ATCGCTGGCGTGAACGCTAGC                            E3
[4]    11 TAGCGGATGCG                                      E4
> names(gs)
[1] "E1" "E2" "E3" "E4"
> ## Reverse order and extract sequences - sequences fine, names not matching
> gtf2 <- gtf[4:1]
> (gs2 <- getSeq(x = genome, names = gtf2))
  A DNAStringSet instance of length 4
    width seq                                              names               
[1]    11 TAGCGGATGCG                                      E2
[2]    21 ATCGCTGGCGTGAACGCTAGC                            E1
[3]    11 AGATTCCATGT                                      E4
[4]    13 CTCGAAAACATGG                                    E3
> names(gs2)
[1] "E2" "E1" "E4" "E3"

> rl <- as(gtf2, "IntegerRangesList")
> extractAt(genome[names(rl)], unname(rl))
DNAStringSetList of length 2
[["chr1"]] E2=ACATGGAATCT E1=CTCGAAAACATGG
[["chr2"]] E4=CGCATCCGCTA E3=ATCGCTGGCGTGAACGCTAGC
> unsplit(extractAt(genome[names(rl)], unname(rl)), seqnames(gtf2))
  A DNAStringSet instance of length 4
    width seq                                              names               
[1]    11 CGCATCCGCTA                                      E2
[2]    21 ATCGCTGGCGTGAACGCTAGC                            E1
[3]    11 ACATGGAATCT                                      E4
[4]    13 CTCGAAAACATGG                                    E3

> sessionInfo()
R Under development (unstable) (2019-10-30 r77336)
Platform: x86_64-apple-darwin15.6.0 (64-bit)
Running under: macOS High Sierra 10.13.6

Matrix products: default
BLAS:   /System/Library/Frameworks/Accelerate.framework/Versions/A/Frameworks/vecLib.framework/Versions/A/libBLAS.dylib
LAPACK: /Library/Frameworks/R.framework/Versions/4.0/Resources/lib/libRlapack.dylib

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

attached base packages:
[1] stats4    parallel  stats     graphics  grDevices utils     datasets 
[8] methods   base     

other attached packages:
[1] BSgenome_1.55.1      rtracklayer_1.47.0   GenomicRanges_1.39.1
[4] GenomeInfoDb_1.23.0  Biostrings_2.55.0    XVector_0.27.0      
[7] IRanges_2.21.1       S4Vectors_0.25.0     BiocGenerics_0.33.0 

loaded via a namespace (and not attached):
 [1] matrixStats_0.55.0          lattice_0.20-38            
 [3] XML_3.98-1.20               Rsamtools_2.3.2            
 [5] GenomicAlignments_1.23.1    bitops_1.0-6               
 [7] grid_4.0.0                  zlibbioc_1.33.0            
 [9] Matrix_1.2-17               BiocParallel_1.21.0        
[11] tools_4.0.0                 Biobase_2.47.0             
[13] RCurl_1.95-4.12             DelayedArray_0.13.0        
[15] compiler_4.0.0              SummarizedExperiment_1.17.0
[17] GenomeInfoDbData_1.2.2